Quantitative real-time PCR (qPCR) The expression of LATS1 mRNA was measured by qPCR using SYBR Premix Ex Taq (Takara, Japan) with an Mx3000P real-time PCR system (Stratagene, La Jolla, CA, USA). For LATS1 analysis, the sequence for sense primer was 5’- GTTAAGGGGAGAGCCAGGTCCTT-3’, and antisense primer was 5’- TCAAGGAAGTCCCCAGGACTGT-3’. Parallel reactions were performed using primers (the sense primer 5’- TCATGGGTGTGAACCATGAGAA -3’ and antisense primer 5’- GGCATGGACTGTGGTCATGAG -3’) for GAPDH as an internal control. Comparative quantification was determined using the 2-ΔΔCt method [16]. Establishment of glioma

U251 cell line stably expressing LATS1 A LATS1 cDNA clone was purchased from GeneCopoeia JNJ-26481585 cell line Incorporation. The preparation of pCDF-GFP lentiviral vectors (SBI Corporation,USA) expressing human LATS1 was performed using the following method: 1) MRT67307 mw LATS1 open reading frame(ORF) LY2603618 mw was amplified

using the forward primer 5’- CTACAGATCTATGAAGAGGAGTGAAAAGCCAGA-3’ and the reverse primer 5’-CAGTAGATCTTTAAACATATACTAGATCGCGATTT -3’ and a BglII restriction endonuclease site was introduced; 2) LATS1 ORF digested with BglII was cloned into a BglII-digested pCDF-GFP lentivirus expression vector; 3) The LATS1 sequence was confirmed by sequence analysis. Further, the resulting lentivirus vector together with two packaging plasmids including pFIV-34 N and pVSV-G were cotransfected into 293FT cells using lipofectamine 2000 (Invitrogen, Carlsbad, CA). An “empty” vector pCDF-GFP was utilized as a negative control. After the titers were determined, the lentiviral particles were used to infect LAST-negative U251 glioma cells. Colonies with GFP expression were selected to expand culture and total RNA of all single cell clones were isolated and quantitative real-time PCR was performed to detect the mRNA

level of LATS1. Each sample was measured at least three times. Western blot analysis Approximately 5 × 106 U251 cells were lysed in RIPA Buffer and total protein concentration determined with BCA assay (Beyotime Inc, China) and 30 μg of total protein was loaded onto a 8% SDS-PAGE gel. Antibodies used for Western blot analysis included: CCNA1 (Abcam, MA, USA, 1:500), anti-ACTB antibody (Santa Cruz, USA, 1:400), and HRP-conjugated anti-rabbit secondary antibody (Zhongshan Inc, 1:2000). Each experiment was performed in triplicate. Phenylethanolamine N-methyltransferase Cell proliferation analysis Cell growth was determined by MTT assay (Sigma, USA). Briefly, 1 × 103 cells were seeded into 96-well plate with quadruplicate for each condition. MTT reagent was added to each well at 5 mg/mL in 20 μL 72 h later and incubated for another 4 h. The formazan crystals formed by viable cells were then solubilized in DMSO and measured at 490 nm for the absorbance (A) values. Each experiment was performed in triplicate. Plate colony formation assay Approximately 100 cells were added to each well of a six-well culture plate.